epsJ [2019-06-21 09:45:54]

UDP-N-acetyl-glucosamine transferase, synthesis of extracellular poly-N-acetylglucosamine

Locus: BSU34280

Isoelectric point: 7.57

Molecular weight: 39.79 kDa

Protein length: 344 aa

Gene length: 1035 bp

Function: synthesis of extracellular poly-N-acetylglucosamine

Product: UDP-N-acetyl-glucosamine transferase

Essential: no

Synonyms: yveT

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Matrix polysaccharide synthesis

Gene

Coordinates: 3,518,999 3,520,033

The protein

Protein family

• glycosyltransferase 2 family (according to Swiss-Prot)

Paralogous protein(s)

• EpsH

Expression and Regulation

Operons

• Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • RemA: activation, PubMed, in RemA regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: anti-activation, (prevents binding of RemA) PubMed, in SinR regulon
  • EAR riboswitch: processive antitermination, in EAR riboswitch

  Regulation

  • repressed by SinR PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed
  • expression is increased in rsiX mutants PubMed

Biological materials

Mutant

• MGNA-A066 (yveT::erm), available at the NBRP B. subtilis, Japan
• BKE34280 (epsJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GACAATAATGCTGACGAGCG, downstream forward: _UP4_ATGAAAGGCAGTGCGAAGCA
• BKK34280 (epsJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GACAATAATGCTGACGAGCG, downstream forward: _UP4_ATGAAAGGCAGTGCGAAGCA

References

Reviews

Loading

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

The EAR RNA switch

Loading